Table S3. Real-time quantitative RT-PCR primers and probes

Gene expression assays
Gene symbol Gene reference Primers, probe
Cyclophilin A NM_021130 (52+) ACGGCGAGCCCTTGG
(117-) TTTCTGCTGTCTTTGGGACCT
FAM-CGCGTCTCCTTTGAGCTGTTTGCA-TAMRA
     
36B4 NM_001002 (193+) AGATGCAGCAGATCCGCAT
(322-) ATATGAGGCAGCAGTTTCTCCAG
FAM-AGGCTGTGGTGCTGATGGGCAAGAA-TAMRA
     
FABP4 NM_001442 (294+) GGATGGAAAATCAACCACCA
(375-)GGAAGTGACGCCTTTCATGA
FAM-ATTCCACCACCAGTTTATCATCCTCTCGTT-TAMRA
     
CD1d NM_001766 (957+) GAGGCCCCACTTTGGGTAA
(1025-) CACTGTTTCCCTCGTCCACTT
 FAM-TGGCCATTCAAGTGCTCAACCAGG-TAMRA
     
TGM2 NM_004613 (529+) CTGGGCCACTTCATTTTGC
(610-) ACTCCTGCCGCTCCTCTTC
FAM-TCCAGGTACACAGCATCCGCTGGG-TAMRA
     
CD1a NM_001763 (1357+) ACCTGTCCTGTCGGGTGAA
(1435-) CCCACGGAACTGTGATGCT
FAM-CAGTCTAGAGGGCCAGGACATCGTCCT-TAMRA
     
RALDH2 NM_003888 (107+) AGGCCCTCCTCGCTCAC
(174-) TGCCCCAGAATGAGCTCA
FAM-ACCCCTCCCTCTCTTCCAAGGAGATG-BQH
     
Predesigned gene expression assays
Gene symbol Gene reference Applera ID
RDH10 NM_172037 Hs00416907_m1   
DHRS9 NM_005771 Hs00608375_m1
Predesigned gene expression assays for TLDA (Fig. 2 C)
Gene symbol Gene reference Applera ID
36B4 NM_001002 Hs99999902_m1
RARα NM_000964 Hs00230907_m1
RARγ NM_000966 Hs00171273_m1
RXRα NM_002957 Hs00172565_m1
RXRβ NM_021976 Hs00232774_m1